CRISPR gRNA Designer
Design SpCas9 guide RNAs from a DNA sequence with PAM and off-target scoring.
Learn more
What it does
The CRISPR gRNA designer scans a target DNA sequence for SpCas9 protospacers: 20 nucleotide spacers sitting immediately 5' of an NGG protospacer-adjacent motif. For every match it reports the spacer, PAM, strand, predicted cut position, GC content and an off-target-aware score, then ranks candidates so you can pick a guide before cloning. It is used by genome-editing researchers, assay developers and students who need a working guide RNA sequence without installing command-line CRISPR software or running a whole-genome alignment.
How it works
The tool slides a window of the chosen spacer length along both strands and keeps any 20-mer whose 3' end is followed by NGG. The PAM may be customized to other motifs such as NAG or TTTV for alternative Cas proteins. Each candidate is scored from a 100 point baseline: it loses 1.2 points for every percentage point of GC content away from the ideal 50%, 25 points for each additional genomic occurrence of the same spacer (a proxy for off-target risk), and 15 points if the spacer contains a homopolymer run such as AAAAA or GGGG. The remaining score ranks guides from safest to riskiest.
Worked example
Take a 95 bp target containing the spacer GACCCTGTACGACATGGACT followed by the PAM TGG. The tool records a 20 nt spacer, a TGG PAM, the plus strand, and a cut site about 3 bp 5' of the PAM (position 23). Its GC content is 55% (11 of 20 bases), that is 5 points from 50%, so it loses 6 score points. If the same 20-mer appears twice in the genome the score drops by 25. A guide scoring above 70 is flagged green as a strong candidate.
When to use it
Use this tool when you need a guide for knock-out, knock-in or base editing and want to avoid sequences that will cut elsewhere in the genome. The biggest pitfall is off-target cutting: a 20-mer with several mismatches can still cleave a related locus, so prefer guides scoring above 70 and verify with a whole-genome off-target search. Avoid spacers with homopolymer runs, which are hard to synthesize and may drop out. Remember that GC content, not just the PAM, controls how well the guide works, and PAMless designs need engineered Cas variants.
FAQ
- What PAM does SpCas9 require?
- SpCas9 from Streptococcus pyogenes recognizes the motif NGG, where N is any nucleotide and G is guanine. The protospacer is 20 nucleotides immediately 5' of the PAM, and cleavage occurs about 3 bp upstream of the PGG. Other Cas proteins use different PAMs, for example SaCas9 needs NNGRRT and NmeCas9 uses NNNGATT, so change the PAM field when designing guides for those enzymes.
- How is the gRNA score calculated?
- Each candidate starts at 100 points. The tool subtracts 1.2 points for every percentage point of GC content away from the ideal 50%, so a 40% or 60% spacer loses 12 points. It subtracts 25 points for each extra genomic occurrence of the same 20-mer, a proxy for off-target cleavage, and 15 points if the spacer contains a homopolymer run such as AAAAA. Scores above 70 are shown as the strongest candidates.
- What spacer length should I use?
- For SpCas9 the standard spacer is 20 nucleotides, which is the default and the most reliable length for cleavage. Shorter spacers of 17-18 nt can improve specificity but weaken cutting, while 22-25 nt spacers broaden targeting yet raise off-target risk. The slider sets the window the tool scans, so keep it near 20 nt unless you are intentionally using a truncated or extended guide.
- How do I reduce off-target effects?
- Pick guides scoring above 70, since the score already penalizes repeated 20-mers in the genome. Avoid spacers with homopolymer runs and extreme GC, and verify the final guide with a whole-genome off-target search rather than trusting the local score. For sensitive edits use a high-fidelity Cas9 variant such as eSpCas9 or HiFi Cas9, and consider a truncated 17-18 nt spacer to sharpen specificity.