Which sites does this tool look for?

attB1 (ACAAGTTTGTACAAAAAAGCAGGCT) and attB2 (ACCCAGCTTTCTTGTACAAAGTGGT). Both must be present on the vector and on the insert.

Do I need BP and LR reactions separately?

Yes in the wet lab: BP moves a PCR product into a donor vector to make the entry clone, LR moves it from the entry clone into the destination vector. This tool models the second transfer.

Can the same entry clone go into several vectors?

That is the main advantage of the system. Once the entry clone exists, the same insert can be shuttled into any compatible destination vector without re-cloning.

What is left behind after recombination?

attB sites flank the insert, adding about 25 bp at each end. When the insert is a coding sequence, remember these become part of the transcript.

Gateway Cloning Calculator

Locate attB1 / attB2 on both molecules and generate the expression clone sequence in one step.

Vector (linearised)

0 bp

Insert / PCR product

0 bp

Both a vector and an insert sequence are required.

Description

Paste a destination vector carrying attB1 and attB2 and an entry clone carrying the same sites. The tool reports where each site sits on both molecules and returns the recombinant expression clone.

How to use

Both the vector and the insert must contain attB1 and attB2. The region between the two sites on the insert replaces the region between the two sites on the vector.

Learn more

What it does

Gateway cloning is a site-specific recombination system derived from bacteriophage lambda. An entry clone carrying attL sites transfers its insert into a destination vector carrying attR sites through an LR reaction, producing an expression clone flanked by attB sites. This tool performs the sequence-level recombination.

How it works

The tool locates attB1 and attB2 on the vector and on the insert, then builds the product as vector up to attB1, followed by attB1, the insert region between its two sites, attB2 and the remainder of the vector. If either molecule is missing a site the reaction is reported as incompatible, with the found/missing sites named.

Worked example

A destination vector with attB1 at position 120 and attB2 at 306, recombined with an entry clone whose insert lies between its own attB1 at 40 and attB2 at 190, gives an expression clone where the 150 bp insert replaces the vector's 186 bp cassette.

When to use it

Use it when moving a library of ORFs into several destination vectors without ever touching a restriction site, or to confirm the exact sequence of an expression clone before transfection.

FAQ

Which sites does this tool look for?: attB1 (ACAAGTTTGTACAAAAAAGCAGGCT) and attB2 (ACCCAGCTTTCTTGTACAAAGTGGT). Both must be present on the vector and on the insert.
Do I need BP and LR reactions separately?: Yes in the wet lab: BP moves a PCR product into a donor vector to make the entry clone, LR moves it from the entry clone into the destination vector. This tool models the second transfer.
Can the same entry clone go into several vectors?: That is the main advantage of the system. Once the entry clone exists, the same insert can be shuttled into any compatible destination vector without re-cloning.
What is left behind after recombination?: attB sites flank the insert, adding about 25 bp at each end. When the insert is a coding sequence, remember these become part of the transcript.

Gibson Assembly CalculatorCheck homology arms and assemble multiple DNA fragments into one sequence.In-Fusion Cloning CalculatorDesign 15 bp homology arms and assemble fragments by homologous recombination.SLiCE Cloning CalculatorPlan Seamless Ligation Cloning Extract reactions with 25 bp homology arms.Plasmid DesignerUpload a GenBank/FASTA plasmid, draw a circular map, annotate restriction sites, and export PNG/SVG.

View all Cloning tools